FASTA Format Description

A sequence in FASTA format starts with a single-line description, followed by lines of sequence data. The description line starts with a right angle bracket (">") and is usually followed by the sequence identifiers and description. Here is an example of a sequence in FASTA as accepted by RASTA-Bacteria.

>gi|30407161:591506-591823 Yersinia pestis CO92 complete genome
GTGATAGGCAACGAGCGTCATGGTTTAGTCGGGGTCATTGGGGCAGATCTTATCCGCAATGCCAAAATCC
CATTAATCCTACTGGTCGCGGTGTTGATCTCTGCCGTGCTCGTCGTGACCACGGCGCATCGTACTCGCTT
ACTGACCGCCGAGCGTGAGCAGTTGGTATTAGAAAGGGATGCGCTGGATATTGAGTGGCGCAACCTAATT
TTAGAAGAGAATGCATTAGGCGATCACAGCCGCGTTGAAAGTATCGCTATTGAAAAACTGAAAATGCAGC
ATGTCGATCCATCACAAGAAAACATTGTGATTAAATAA
		

Nb: Because of the interface library used to send RASTA-Bacteria queries to the computing server, for consistency reasons we advise users not to use symbols ':', '|', '&' and ',' in their sequence header, as these will be removed for the software to proceed.